ORIGINAL ARTICLE
TP53 Arg72Pro Genetic Polymorphism and Young Women with Breast Cancer: Case-Control Study in Brazil
Polimorfismo Genético TP53 Arg72Pro e Câncer de Mama em Mulheres Jovens: Estudo Caso-Controle no Brasil
Polimorfismo Genético TP53 Arg72Pro y Cáncer de Mama en Mujeres Jóvenes: Estudio de Casos y Controles en el Brasil
doi: https://doi.org/10.32635/2176-9745.RBC.2023v69n2.3674
Sabrina da Silva Santos1; Rafaela Soares Senra da Costa2; Lilian Freire Diniz3; Rafaela Matos Ferreira4; Guillermo Patricio Ortega Jácome5; Rosalina Jorge Koifman6
1,2,3,4,6Fundação Oswaldo Cruz (Fiocruz). Escola Nacional de Saúde Pública (Ensp). Rio de Janeiro (RJ), Brazil. E-mails: sabrina.santos@ensp.fiocruz.br; rafaelasenra@hotmail.com; diniz.lilianfreire@gmail.com; rafaela.matossr@gmail.com; rosalina.koifman@hotmail.com. Orcid iD: https://orcid.org/0000-0001-8327-3546;
Orcid iD: https://orcid.org/0000-0003-1535-850X; Orcid iD: https://orcid.org/0000-0002-4892-7513; Orcid iD: https://orcid.org/0000-0001-6921-4427; Orcid iD: https://orcid.org/0000-0002-2746-7597
5Universidade Presidente Antônio Carlos (Unipac). Juiz de Fora (MG), Brazil. E-mail: guipatortega@yahoo.com.br. Orcid iD: https://orcid.org/0000-0002-2107-1292
Corresponding author: Sabrina da Silva Santos. Fiocruz/Esnp. Rua Leopoldo Bulhões, 1480 – Manguinhos. Rio de Janeiro (RJ), Brazil. CEP 21041-210. E-mail: sabrina_ssantos@hotmail.com
ABSTRACT
Introduction: Breast cancer is the most common cancer in women and incidence and mortality rates are increasing among young women worldwide, including Brazil. TP53 Arg72Pro polymorphism (rs1042522) has been associated with breast cancer, due to its important role in cell cycle that impacts the development of cancer. Objective: To determine the magnitude of the association between TP53 Arg72Pro polymorphism and breast cancer development in young Brazilian women. Method: Hospital-based case-control study conducted in Rio de Janeiro with 268 confirmed breast cancer cases and 277 controls with women enrolled among hospitalized patients without neoplastic diseases or their companions at three public hospitals. Results: The genotype frequency was 46.57% for Arg/Pro, 35.74% for Arg/Arg, and 17.69% for Pro/Pro among healthy controls and 41.04% for Arg/Pro, 46.64% for Arg/Arg, and 12.31% for Pro/Pro among breast cancer cases. The genotypes Pro/Pro (OR=0.46; 95% CI=0.27-0.80, in comparison with Arg/Arg genotype) and Pro allele in dominant model (OR=0.65; 95% CI=0.45-0.92, in comparison with Arg/Arg genotype) were statistically associated with a protective effect for breast cancer among young Brazilian women. Also, family history of breast or ovary cancer (OR=2.18; 95% CI=1.37-3.46) and tobacco use (OR=1.74; 95% CI=1.14-2.68) were statistically associated with breast cancer. Conclusion: Further studies are necessary to confirm that Arg72Pro polymorphism can be a protective factor for breast cancer development among young women, since ethnicity can influence genotypes frequencies and the risk of developing breast cancer.
Key words: breast neoplasms; genes, p53; polymorphism, genetic; young adult.
RESUMO
Introdução: O câncer de mama é o mais comum em mulheres e as taxas de incidência e mortalidade estão aumentando entre mulheres jovens em todo o mundo, inclusive no Brasil. O polimorfismo TP53 Arg72Pro (rs1042522) tem sido associado ao câncer de mama em razão do seu importante papel no ciclo celular que pode impactar o desenvolvimento do câncer. Objetivo: Determinar a magnitude da associação entre o polimorfismo TP53 Arg72Pro e o desenvolvimento de câncer de mama em mulheres jovens brasileiras. Método: Estudo caso-controle de base hospitalar realizado no Rio de Janeiro com 268 casos confirmados de câncer de mama e 277 controles com mulheres cadastradas entre pacientes internados sem doenças neoplásicas ou seus acompanhantes em três hospitais públicos. Resultados: A frequência genotípica foi de 46,57% para Arg/Pro, 35,74% para Arg/Arg e 17,69% para Pro/Pro entre controles saudáveis e 41,04% para Arg/Pro, 46,64% para Arg/Arg e 12,31% para Pro /Pro entre os casos de câncer de mama. Os genótipos Pro/Pro (OR=0,46; IC 95%=0,27-0,80, em comparação ao genótipo Arg/Arg) e o alelo Pro no modelo dominante (OR=0,65; IC 95%=0,45-0,92, em comparação com o genótipo Arg/Arg) foram estatisticamente associados a um efeito protetor para o câncer de mama em mulheres jovens brasileiras. Além disso, história familiar de câncer de mama ou ovário (OR=2,18; IC 95%=1,37-3,46) e tabagismo (OR=1,74; IC 95%=1,14-2,68) foi estatisticamente associada ao câncer de mama. Conclusão: Novos estudos são necessários para confirmar que o polimorfismo Arg72Pro pode ser um fator de proteção para o desenvolvimento de câncer de mama em mulheres jovens, uma vez que a etnia pode influenciar tanto as frequências desses genótipos quanto o risco de desenvolver câncer de mama.
Palavras-chave: neoplasias da mama; genes p53; polimorfismo genético; adulto jovem.
RESUMEN
Introducción: El cáncer de mama es el cáncer más común en la mujer y las tasas de incidencia y mortalidad están aumentando entre las mujeres jóvenes en todo el mundo, incluido Brasil. El polimorfismo TP53 Arg72Pro (rs1042522) se ha asociado con el cáncer de mama, debido a su importante papel en el ciclo celular que puede afectar el desarrollo del cáncer. Objetivo: Determinar la magnitud de la asociación entre el polimorfismo TP53 Arg72Pro y el desarrollo de cáncer de mama en mujeres jóvenes brasileñas. Método: Estudio de casos y controles de base hospitalaria realizado en Río de Janeiro con 268 casos confirmados de cáncer de mama y 277 controles con mujeres inscritas entre pacientes hospitalizadas sin enfermedades neoplásicas o sus acompañantes en tres hospitales públicos. Resultados: La frecuencia de genotipos fue del 46,57% para Arg/Pro, 35,74% para Arg/Arg y 17,69% para Pro/Pro entre controles sanos y 41,04% para Arg/Pro, 46,64% para Arg/Arg y 12,31% para Pro/Pro entre los casos de cáncer de mama. El genotipo Pro/Pro (OR=0,46; IC 95%=0,27-0,80, en comparación con el genotipo Arg/Arg) y el alelo Pro en el modelo dominante (OR=0,65; IC del 95 %=0,45-0,92, en comparación con el genotipo Arg/Arg) se asociaron estadísticamente con un efecto protector frente el cáncer de mama entre mujeres jóvenes brasileñas. Además, los antecedentes familiares de cáncer de mama o de ovario (OR=2,18; IC 95%=1,37-3,46) y el hábito del tabaquismo (OR=1,74; IC 95%=1,14-2,68) se asociaron estadísticamente con el cáncer de mama. Conclusión: Son necesarios nuevos estudios para confirmar que el polimorfismo Arg72Pro puede ser un factor de protección para el desarrollo del cáncer de mama en mujeres jóvenes, ya que la etnia puede influir r tanto en las frecuencias de estos genotipos como en el riesgo de desarrollar cáncer de mama.
Palabras clave: neoplasias de la mama; genes p53; polimorfismo genético; adulto joven.
INTRODUCTION
Breast cancer is the most common among women worldwide1. According to the International Agency for Research on Cancer (IARC)1, 215 million new cases are estimated for 2025 and 769 thousand deaths are expected globally, a clear aggravation of this worldwide public health problem. Furthermore, there has been an increase of incidence and mortality rates by this neoplasm worldwide among young women2-5.
Literature shows some risk factors as possibly associated with breast cancer development among young women as alcohol and tobacco use, family history of breast cancer and some punctual mutations mainly in BRCA 1, BRCA 2 and TP53 genes2,6-8. TP53 gene is a constitutive tumor suppressor gene that is part of the biological mechanisms that act in cell control, which encodes a protein called p539,10. This protein is a transcriptional regulator induced by DNA damage, a fact that results in cell cycle arrest with consequent activation of repair mechanisms or even induction of apoptosis10-13. Besides mutations, TP53 is a polymorphic gene and Arg72Pro polymorphism (rs1042522) is the most investigated in relation to associations with different neoplasms, however the results are still conflicting in relation to breast cancer. Presence of this single nucleotide polymorphism (SNP) leads to the encoding of a protein with the amino acid proline (Pro) in codon 72, replacing the amino acid arginine (Arg) encoded by the wild type allele. This substitution is produced by a single nucleotide exchange from guanine to cytosine and can impact in different ways in DNA damage induction according the presence of Arg or Pro allele9,10,13. In brief, Arg protein was reported to be more efficient in inducing apoptosis than the Pro variant, due to the greater efficiency of the Arg variant to localize to mitochondria10-13. The allele frequency of Arg in this codon is approximately 70% for the Caucasian population14.
Given the importance of this gene in the process of cell growth and cancer development, this study aims to evaluate the association between Arg72Pro polymorphism with breast cancer development in young Brazilian women.
METHOD
The study design consisted in a case-control study with women living in the Metropolitan Region of Rio de Janeiro, Brazil and detailed in a previous study15. The cases comprehended 268 women with confirmed histopathological diagnosis of breast cancer (ICD 10 50.0-50.9), at the age range of 18-35 years, referred to the National Cancer Institute (INCA), an oncological reference center in the city of Rio de Janeiro, between 1999 and 2009.
The controls included 277 women enrolled among hospitalized patients without neoplastic diseases or patient’s companions at three public hospitals, Hospital Pro-Matre, Instituto Nacional de Traumatologia e Ortopedia Jamil Haddad (INTO) and Hospital da Lagoa that offered cost-free care in the same city. Participants signed the informed consent form and were interviewed in-person by skilled interviewers, with the application of a study-designed standard questionnaire. After, peripheral blood samples were collected in EDTA Vacutainer tubes for genomic DNA extraction, following a salting out technique standard protocol16. The Institutional Review Board of INCA, Pro-Matre, Hospital da Lagoa and Escola Nacional de Saúde Pública (Ensp/Fiocruz) approved the study (CAAE: 0191.0.031.000-10).
TP53 genetic polymorphism was assessed by previously described polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) protocols with minor modifications17. Target DNA amplification was achieved by PCR optimized conditions: a final reaction volume of 25 μL composed of 100-200 ng of DNA, 0.2 mM of each dTNP (Invitrogen), 3 mM of MgCl2, 0.75 U of Platinum Taq DNA polymerase (Invitrogen), 1× PCR buffer (Invitrogen), and 10 pmol of each primer (forward 5’atctacagtcccccttgccg3’ and reverse 5’gcaactgaccgtgcaagtca3’). The reaction conditions used were a pre-denaturation at 94oC for 5 min followed by 35 cycles with three steps each (94oC for 30 s, 68oC for 30 s, and 72oC for 40 s), and a cycle of 7 min at 72oC. Negative controls were included in every run, and amplification success was confirmed in agarose 1.5% gels, stained with Gel Red (Biotium), and visualized under ultraviolet light. Endonuclease digestions were performed in a final reaction volume of 20 μL consisting in 3μL of PCR products, 6U of BstUI enzyme (New England Biolabs), and 1× reaction buffer (New England Biolabs), using overnight 60oC incubation conditions. Genotypes determination was performed in agarose 3% gels.
Genotype distribution goodness-of-fit to Hardy-Weinberg equilibrium was ascertained for controls, using R 2.15.2 software.
Continuous variables were expressed as means ± standard deviation (SD) and differences between them were analyzed using the Mann-Whitney U test. Categorical variables were expressed as percentages and Pearson chi-square was used to analyze differences between them.
Unconditional logistic regression models were used to calculate unadjusted and adjusted odds ratios (OR) and 95% confidence intervals (95% CI) for association between TP53 polymorphism and breast cancer, using STATA 10.0 software. P-value <0.05 was used to ascertain occurrence of statistical significance. All confounders (age, skin color, education, pregnancy, age at menarche, hormonal contraceptives use and family history of breast and/or ovary cancer of first-degree relatives) was tested in logistic regression, and those that do not modify breast cancer association and genetic polymorphisms were eliminated at the final model.
RESULTS
Breast cancer cases and controls distribution according to age, skin color, occurrence of pregnancy, age at menarche and family history of breast or ovary cancer are presented at Table 1. Mean age was 31.5 years (±3.4) among cases and 29.9 years (±4.5) among controls. White individuals accounted for 30.2% of the cases and 31.8% of controls; 69.8% of the cases and 68.2% of controls were non-White (p=0.70). Family histories of breast or ovary cancer, in first degree relatives, were reported by 22.8% of the cases and 11.9% of controls and were statistically associated with breast cancer development among young women (OR=2.18; 95% CI=1.37-3.46). Tobacco use also showed statistical association with breast cancer in this population (OR=1.74; 95% CI=1.14-2.68).
|
Table 1. Distribution of breast cancer cases (n=268) and controls (n=277) according to epidemiological data. Rio de Janeiro, Brazil, 1999-2012 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Captions: OR = odds ratios; CI = 95% confidence interval. (a) χ2 test. (b) Mann-Whitney U test. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
The association between Arg72Pro TP53 polymorphism and breast cancer is presented in Table 2. The genotypes Pro/Pro and Arg/Pro were statistically associated with a protective effect for breast cancer in young women (OR=0.53, 95% CI=0.32-0.89). The OR adjustment for age and skin color revealed a negative association even greater for Pro/Pro genotype (OR=0.46, 95% CI=0.27-0.80), however for Arg/Pro genotype the association becomes non-significant after this adjustment (OR=0.70, 95% CI=0.48-1.02). Considering the dominant model, it was noticed a statistically significant protective effect of the presence of at least one Pro allele (Pro/Pro + Arg/Pro) in comparison to Arg/Arg genotype (OR=0.64; 95% CI=0.45-0.90). The OR adjustment for age and skin color keeps the association (OR=0.65, 95% CI=0.45-0.90).
|
Table 2. Distribution of breast cancer cases and controls according to TP53 genotypes. Rio de Janeiro, Brazil, 1999-2012 |
||||||||||||||||||||||||||||||||||||||||||||||||||
|
||||||||||||||||||||||||||||||||||||||||||||||||||
|
Captions: OR = odds ratios; CI = 95% confidence interval. (*) TP53 Hardy-Weinberg p=0.72. (a) Age and skin color adjusted. |
DISCUSSION
To the best of the existing knowledge, this was the first study to investigate Arg72Pro SNP genotypes frequencies among young women with a histopathological confirmed diagnosis of breast cancer (ICD 10 50.0-50.9) in Brazil. Thus, Arg/Arg genotype was the most frequent in this population (46.64%) with breast cancer, followed by Arg/Pro genotype (41.04%), and Pro/Pro genotype (12.31%). Among cancer cases, it was shown that the frequency of Arg/Arg genotype varied from 8.0% in Brazil to 91.9% in China, while the frequency of the Pro/Pro genotype ranged from 0% in China to 54.0% in Russia18-20.
The frequency of the Arg/Pro genotypes varied from 8.1% in China to 69.4% in Saudi Arabia19,21. In Brazil, for women diagnosed with breast cancer, without age limitation, case-control studies estimated genotypes frequency ranged from 8.0% to 55.5% for Arg/Arg genotype, from 40.3% to 60.0% for Arg/Pro genotype, and from 4.2% to 32.0% for Pro/Pro genotype22-27. There is also an ethnicity variation among breast cancer women, according to the Brazilian regions, with Arg/Arg genotype frequencies ranging from 44.7% to 55.5% in Brazil’s South region23,24,26; whereas in the Southeast and Northeast regions, Arg/Pro genotype was the most frequent, varying from 41.4% to 60%22,25,27.
This wide variation of Arg72Pro SNP frequencies according to ethnicity, favors the observation of different associations of this SNP with the development of breast cancer28. Among the young women investigated, the genotype Pro/Pro was statistically associated with a protective effect for breast cancer (OR=0.46, 95% CI=0.27-0.80, Arg/Arg genotype as reference and adjusted for age and skin color). Alawadi et al.21 in their case-control study in Saudi Arabia with 288 breast cancer women and 188 controls also found that Pro/Pro genotype was a protective factor for breast cancer (OR=0.17, 95% CI=0.07-0.41), with a median age of 54.74 years to cases and 48.74 years to controls and the genotyping was performed by the PCR-RFLP method21.
Other three case-control studies29-31 also corroborate the conclusions that Pro/Pro genotype is a protective factor for breast cancer development, although in these articles the OR was calculated using Pro/Pro genotype as reference. So, Yulug et al.29, studying Turkish and Greek populations with 138 breast cancer cases and 138 blood donors as controls in Greece, and 274 breast cancer cases and 221 blood donors as controls in Turkey, concluded, among Turkish women, a great statistical association of the Arg/Arg genotype with breast cancer (OR=2.16, 95% CI=1.08-4.31)29. For Greek women, a great association, but without statistical significance with Arg/Arg genotype was found (OR=7.93, 95% CI=0.95-65.98). Genotyping was also performed by the PCR-RFLP method and median age was 49.30 years to cases and 46.59 years to controls29. Gochhait et al.30, in their case-control study conducted in India with 243 breast cancer women and 333 healthy controls, observed, by sequencing method, a great statistical significance association of breast cancer development with Arg/Arg genotype (OR=2.30, 95% CI=1.4-3.6)30. And Proestling et al.31, in Austria, with 267 breast cancer women and 220 healthy controls, with global median age of 58.7 years, noticed a great statistical significance association of this neoplasia with Arg/Arg genotype (OR=2.38, 95% CI=1.01-5.93).
Further, the dominant model (Pro/Pro+Arg/Pro versus Arg/Arg) suggested a significant protective effect of the presence of Pro allele for breast cancer, among Brazilian young women (OR=0.65; 95% CI=0.45-0.92). Similar result was observed by Liu et al.19, who conducted a case-control study in China with 1,100 breast cancer women and 1,400 controls paired by age, finding a protective association of Pro/Pro+Arg/Pro versus Arg/Arg (OR=0.45, 95% CI=0.35-0.59).
Although the studies referenced corroborate the present results, many studies do not find an association between the presence of this polymorphism and the development of breast cancer22. Apparently, most of the studies that found a statistically significant association suggest that the presence of Pro allele is a risk factor for the development of the disease and not a protective instead24,32-34. Unfortunately, most of these studies were very small samples-based, a clear limitation, except for The Breast Cancer Association Consortium35, which combines the population of different countries.
Indeed, this combination of different populations can also be a limitation, considering the wide variation in Arg72Pro SNP frequencies, according to ethnicity, that can influence its association with breast cancer. This was detected in two recent metanalysis about the theme. Gonçalves et al.36 showed a small increased risk due to the presence of Pro allele in the dominant model (OR=1.11, 95% CI=1.02-1.21; versus Arg/Arg), but not in Asia, where the risk was associated with the presence of Arg allele (OR=1.23, 95% CI=1.07-1.41; versus Pro/ Pro - Recessive model). Diakite et al.37 found that Pro allele was associated with an extremely small increased risk of breast cancer in the dominant model for overall analyses (OR=1.09, 95% CI=1.02-1.16). This result was quite similar for Caucasian populations, but the authors did not find statistically significant results in the Asian population37. So, despite the importance of TP53 gene, the association of Arg72Pro SNP and the development of breast cancer remains inconclusive.
The study of Arg72Pro SNP is complex since each one of the alleles can promote different BRAC1/2 transcription, causing dissimilar advantages in terms of protecting cells against breast tumorigenesis30,38,39,40-45. Pro allele appears to better perform G1 arrest than the Arg variant protein30,46,47. Besides that, Pro allele shows a decreased efficiency at triggering apoptosis, mainly due to its decreased ubiquination by MDM2 and to its increased efficiency to bind apoptosis-stimulating inhibitor of apoptosis-stimulating p53 protein (iASPP)30,41,48-52. Furthermore, in order to understand cancer as a multifactorial disease, it is also important to know the population's ethnicity and age for breast cancer development, other mutations or polymorphisms, especially those in the BRCA1 or BRCA2 genes, as well as environment interactions.
Other articles2,53-57 which investigated the association between Arg72Pro SNP and the development of breast cancer did not limit the age of the study population analyzed or performed subgroup analysis according to this variable, an important aspect to highlight. The combination of pre-and post-menopausal women may not be a good strategy, since some risk factors seem to be different for these two populations2,53-57. Besides that, multiple studies6,58,59 have suggested that breast cancer in young women could be more aggressive, and with worse prognosis, regardless of pathologic variables. The scientific community is starting to consider that breast cancer among young women could present a different biologic entity58. In this scenario, it is difficult to compare the present results of a negative association of Arg72Pro TP53 Pro allele with breast cancer in young women according with the studies published so far.
The main strength of this article is the restriction to young women, which is a form to prevent age from being a confounding factor of the results. Finally, another advantage is the use of a large sample size in comparison with others case-controls studies. However, the genotyping method applied in the present study can be considered a limitation, efforts were endeavored to make sure that PCR-RFLP technique related errors were eliminated through replication analysis for 10% of the samples, in order to validate the correct classification.
It is known that breast cancer is considered a multifactorial disease, suggesting that a single polymorphism is probably insufficient to produce disease phenotype, being necessary environmental factors interacting with gene polymorphism/mutations to affect breast cancer risk60. However, biological mechanisms by which such interactions modulate breast cancer risk development among young women is still not totally clear, it is already known that family history of breast or ovary cancer is an important risk factor and it seems that tobacco use may be an important environmental factor associated with breast cancer in this young population61-66. In the present study, an association of family history of breast or ovary cancer and tobacco use with breast cancer in young women was found.
Knowledge about family history is considered essential when evaluating young women with breast cancer67. Many studies6,54,55,67 concluded that breast or ovary cancer family history could help to identify individuals at elevated risk for hereditary breast cancer or women who would benefit from increased breast cancer surveillance. Many international guidelines also recommend assessment of family history and screening patients at increased risk of breast cancer67. One of them, the American College of Obstetricians and Gynecologists53, states that screening should include at least a personal cancer history of first and second-degree relatives’ cancer history, including information as description of primary cancer type, age of onset, and lineage of the family member.
Several studies68,69 suggest that tobacco acts since the initiation to neoplastic progression, mainly in cells of epithelial origin, and there are strong evidences that the breast tissue is a target for these carcinogenic effects. Epidemiological studies70,71 also corroborate these evidences, as tobacco use has been associated with increased risk of breast cancer.
Some studies72,73 show that breast cancer mortality rate among Brazilian young women has been increasing in all country regions, mostly for women from 30-39 years old and tobacco use is increasing among Brazilian women.
It is quite clear that to investigate the association between tobacco use and the development of breast cancer in young women is an important initiative and bring awareness to these women about all the risks associated.
CONCLUSION
The results suggest that the presence of at least one Pro allele can be a protective factor for breast cancer development among young women. In addition, it is important to cite that the present study is relevant to show Arg72Pro polymorphism frequencies in a mixed-race population such as Brazil, since ethnicity can influence genotypes frequencies and the risk of developing breast cancer in young women. Besides that, future studies with different study designs, genotyping techniques, and larger sample size are required to test hypotheses raised from this investigation.
ACKNOWLEDGMENTS
To the INCA, Hospital Pro-Matre, INTO, Hospital da Lagoa, employees,
patients and healthy women for their support and collaboration.
CONTRIBUTIONS
The authors participated in all the phases of the manuscript and approved the final version to be published.
DECLARATION OF CONFLICT OF INTERESTS
There is no conflict of interest to declare.
FUNDING SOURCES
None.
REFERENCES
1. Sung H, Ferlay J, Siegel RL, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71(3):209-249. doi: https://doi.org/10.3322/caac.21660
2. Anastasiadi Z, Lianos GD, Ignatiadou E, et al. Breast cancer in young women: an overview. Updat Surg. 2017;69(3):313-7. doi: https://doi.org/10.1007/s13304-017-0424-1
3. Eiriz IF, Vaz Batista M, Cruz Tomás T, et al. Breast cancer in very young women--a multicenter 10-year experience. ESMO Open. 2021;6(1):100029. doi: https://doi.org/10.1016/j.esmoop.2020.100029
4. Sopik V. International variation in breast cancer incidence and mortality in young women. Breast Cancer Res Treat. 2020;186(2):497-507. doi: https://doi.org/10.1007/s10549-020-06003-8
5. Pinheiro AB, Lauter DS, Medeiros GC, et al. Câncer de mama em mulheres jovens: análise de 12.689 casos. Rev Bras Cancerol. 2013;59(3):3519. doi: https://doi.org/10.32635/2176-9745.RBC.2013v59n3.500
6. Khushalani JS, Qin J, Ekwueme DU, et al. Awareness of breast cancer risk related to a positive family history and alcohol consumption among women aged 15-44 years in United States. Prev Med Rep. 2020;17:101029. doi: https://doi.org/10.1016/j.pmedr.2019.101029
7. Natarajan R, Aljaber D, Au D, et al. Environmental exposures during puberty: window of breast cancer risk and epigenetic damage. Int J Environ Res Public Health. 2020;17(2):493. doi: https://doi.org/10.3390/ijerph17020493
8. Querzoli P, Albonico G, di Iasio MG, et al. Biophenotypes and survival of BRCA1 and TP53 deleted breast cancer in young women. Breast Cancer Res Treat. 2001;66(2):135-42. doi: https://doi.org/10.1023/a:1010643515095
9. Hollstein M, Sidransky D, Vogelstein B, et al. p53 mutations in human cancers. Science. 1991;253(5015):49-53. doi: https://doi.org/10.1126/science.1905840
10. Ozcelik H, Pinnaduwage D, Bull SB, et al. Type of TP53 mutation and ERBB2 amplification affects survival in node-negative breast cancer. Breast Cancer Res Treat. 2007;105(3):255-65. doi: https://doi.org/10.1007/s10549-006-9452-0
11. Done SJ, Eskandarian S, Bull S, et al. p53 missense mutations in microdissected high-grade ductal carcinoma in situ of the breast. J Natl Cancer Inst. 2001;93(9):700-4. doi: https://doi.org/10.1093/jnci/93.9.700
12. Rohan TE, Li SQ, Hartwick R, et al. p53 alterations and protein accumulation in benign breast tissue and breast cancer risk: a cohort study. Cancer Epidemiol Biomarkers Prev. 2006;15(7):1316-23. doi: https://doi.org/10.1158/1055-9965.EPI-06-0195
13. Sjögren S, Inganäs M, Norberg T, et al. The p53 gene in breast cancer: prognostic value of complementary DNA sequencing versus immunohistochemistry. J Natl Cancer Inst. 1996;88(3-4):173-82. doi: https://doi.org/10.1093/jnci/88.3-4.173
14. Donehower LA. p53: guardian AND suppressor of longevity? Exp Gerontol. 2005;40(1-2):7-9. doi: https://doi.org/10.1016/j.exger.2004.10.007
15. Santos SS, Jácome GPO, Koifman R, et al. CYP17, CYP19, and NQO1 genetic polymorphisms and breast cancer susceptibility in young women in Brazil. Br J Med Med Res. 2014;4(1):68-80. doi: https://doi.org/10.9734/BJMMR/2014/4254
16. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988;16(3):1215. doi: https://doi.org/10.1093/nar/16.3.1215
17. Lee JM, Lee YC, Yang SY, et al. Genetic polymorphisms of p53 and GSTP1,but not NAT2,are associated with susceptibility to squamous-cell carcinoma of the esophagus. Int J Cancer. 2000;89(5):458-64. doi: https://doi.org/10.1002/1097-0215(20000920)89:5<458::AID-IJC10>3.0.CO;2-R
18. Ramalho EA, Silva-Filho JL, Cartaxo MF, et al. Assessment of changes in the BRCA2 and P53 genes in breast invasive ductal carcinoma in northeast Brazil. Biol Res. 2014;47(1):3. doi: https://doi.org/10.1186/0717-6287-47-3
19. Liu J, Tang X, Li M, et al. Functional MDM4 rs4245739 genetic variant, alone and in combination with P53 Arg72Pro polymorphism, contributes to breast cancer susceptibility. Breast Cancer Res Treat. 2013;140(1):151-7. doi: https://doi.org/10.1007/s10549-013-2615-x
20. Suspitsin EN, Buslov KG, Grigoriev MY, et al. Evidence against involvement of p53 polymorphism in breast cancer predisposition. Int J Cancer. 2003;103(3):431-3. doi: https://doi.org/10.1002/ijc.10834
21. Alawadi S, Ghabreau L, Alsaleh M, et al. P53 gene polymorphisms and breast cancer risk in Arab women. Med Oncol. 2011;28(3):709-15. doi: https://doi.org/10.1007/s12032-010-9505-4
22. Almeida BC, Kleine JPFO, Camargo-Kosugi CM, et al. Analysis of polymorphisms in codons 11, 72 and 248 of TP53 in Brazilian women with breast cancer. Genet Mol Res. 2016;15(1). doi: https://doi.org/10.4238/gmr.15017055
23. Aoki MN, Herrera ACSA, Amarante MK, et al. CCR5 and p53 codon 72 gene polymorphisms: implications in breast cancer development. Int J Mol Med. 2009;23(3):429-35. doi: https://doi.org/10.3892/ijmm_00000148
24. Damin APS, Frazzon APG, Damin DC, et al. Evidence for an association of TP53 codon 72 polymorphism with breast cancer risk. Cancer Detect Prev. 2006;30(6):523-9. doi: https://doi.org/10.1016/j.cdp.2006.09.007
25. Mayorano MB. Polimorfismos dos genes TP53 e MDR-1, susceptibilidade e resposta à quimioterapia neoadjuvante em pacientes com câncer de mama [tese na Internet] Ribeirão Preto (SP): Faculdade de Medicina de Ribeirão Preto; 2008. doi: https://doi.org/10.11606/T.17.2008.tde-24102008-153640
26. Melo MP, Bittelbrunn AC, Menke CH, et al. Analysis of the R72P polymorphism of the TP53 gene in patients with invasive ductal breast carcinoma. Mol Med Rep. 2009;2(5):793-7. doi: https://doi.org/10.3892/mmr_00000174
27. Ramalho EAVF. Avaliação de alterações nos genes p53, BRCA1 em Carcinoma Ductal Invasivo de Mama (CDI) [dissertação na Internet]. Recife (PE): Universidade Federal de Pernambuco; 2012 [acesso 2022 nov 23]. Disponível em: https://repositorio.ufpe.br/handle/123456789/10853
28. Soleimani A, Rahmani Y, Farshchian N, et al. The evaluation of p53 polymorphism at codon 72 and association with breast cancer in Iran: a systematic review and meta-analysis. J Cancer Prev. 2016;21(4):288-93. doi: https://doi.org/10.15430/JCP.2016.21.4.288
29. Yulug I, Çolakoglu G, Bozkurt B, et al. p53 codon 72 and p21 codon 31 polymorphisms and susceptibility to breast cancer in the Turkish and Greek populations. EJC Suppl. 2005;3(2):80. doi: https://doi.org/10.1016/S1359-6349(05)80581-6
30. Gochhait S, Bukhari SIA, Bairwa N, et al. Implication of BRCA2 -26G>A 5’ untranslated region polymorphism in susceptibility to sporadic breast cancer and its modulation by p53codon 72 Arg>Pro polymorphism. Breast Cancer Res. 2007;9(5):R71. doi: https://doi.org/10.1186/bcr1780
31. Proestling K, Hebar A, Pruckner N, et al. The Pro allele of the p53 codon 72 polymorphism is associated with decreased intratumoral expression of BAX and p21, and increased breast cancer risk. PloS One. 2012;7(10):e47325. doi: https://doi.org/10.1371/journal.pone.0047325
32. Fukushima T, Tan X, Luo Y, et al. Relationship between blood levels of heavy metals and Parkinson’s disease in China. Neuroepidemiology. 2010;34(1):18-24. doi: https://doi.org/10.1159/000255462
33. Hossain A, Murshid GMM, Zilani MNH, et al. TP53 codon 72 polymorphism and breast cancer risk in Bangladeshi population. Breast Cancer. 2017;24(4):571-8. doi: https://doi.org/10.1007/s12282-016-0740-1
34. Rodrigues P, Furriol J, Tormo E, et al. Epistatic interaction of Arg72Pro TP53 and −710 C/T VEGFR1 polymorphisms in breast cancer: predisposition and survival. Mol Cell Biochem. 2013;379:181-90. doi: https://doi.org/10.1007/s11010-013-1640-8
35. Breast Cancer Association Consortium. Commonly studied single-nucleotide polymorphisms and breast cancer: results from the Breast Cancer Association Consortium. J Natl Cancer Inst. 2006;98(19):1382-96. doi: https://doi.org/10.1093/jnci/djj374
36. Gonçalves ML, Borja SM, Cordeiro JABL, et al. Association of the TP53 codon 72 polymorphism and breast cancer risk: a meta-analysis. Springerplus. 2014;3:749. doi: https://doi.org/10.1186/2193-1801-3-749
37. Diakite B, Kassogue Y, Dolo G, et al. p.Arg72Pro polymorphism of P53 and breast cancer risk: a meta-analysis of case-control studies. BMC Med Genet. 2020;21(1):206. doi: https://doi.org/10.1186/s12881-020-01133-8
38. Baynes C, Healey CS, Pooley KA, et al. Common variants in the ATM, BRCA1, BRCA2, CHEK2 and TP53 cancer susceptibility genes are unlikely to increase breast cancer risk. Breast Cancer Res. 2007;9(2):R27. doi: https://doi.org/10.1186/bcr1669
39. Cavallone L, Arcand SL, Maugard C, et al. Haplotype analysis of TP53 polymorphisms, Arg72Pro and Ins16, in BRCA1 and BRCA2 mutation carriers of French Canadian descent. BMC Cancer. 2008;8:96. doi: https://doi.org/10.1186/1471-2407-8-96
40. Huang XE, Hamajima N, Katsuda N, et al. Association of p53 codon Arg72Pro and p73 G4C14-to-A4T14 at exon 2 genetic polymorphisms with the risk of Japanese breast cancer. Breast Cancer. 2003;10(4):307-11. doi: https://doi.org/10.1007/BF02967650
41. Lum SS, Chua HW, Li H, et al. MDM2 SNP309 G allele increases risk but the T allele is associated with earlier onset age of sporadic breast cancers in the Chinese population. Carcinogenesis. 2008;29(4):754-61. doi: https://doi.org/10.1093/carcin/bgn024
42. Martin AM, Kanetsky PA, Amirimani B, et al. Germline TP53 mutations in breast cancer families with multiple primary cancers: is TP53 a modifier of BRCA1? J Med Genet. 2003;40(4):e34. doi: https://doi.org/10.1136/jmg.40.4.e34
43. Osorio A, Pollán M, Pita G, et al. An evaluation of the polymorphisms Ins16bp and Arg72Pro in p53 as breast cancer risk modifiers in BRCA1 and BRCA2 mutation carriers. Br J Cancer. 2008;99(6):974-7. doi: https://doi.org/10.1038/sj.bjc.6604624
44. Sinilnikova OM, Antoniou AC, Simard J, et al. The TP53 Arg72Pro and MDM2 309G>T polymorphisms are not associated with breast cancer risk in BRCA1 and BRCA2 mutation carriers. Br J Cancer. 2009;101(8):1456-60. doi: https://doi.org/10.1038/sj.bjc.6605279
45. Tommiska J, Eerola H, Heinonen M, et al. Breast cancer patients with p53 Pro72 homozygous genotype have a poorer survival. Clin Cancer Res. 2005;11(14):5098-103. doi: https://doi.org/10.1158/1078-0432.CCR-05-0173
46. Thomas M, Kalita A, Labrecque S, et al. Two polymorphic variants of wild-type p53 differ biochemically and biologically. Mol Cell Biol. 1999;19(2):1092-100. doi: https://doi.org/10.1128/MCB.19.2.1092
47. Petitjean A, Achatz MIW, Borresen-Dale AL, et al. TP53 mutations in human cancers: functional selection and impact on cancer prognosis and outcomes. Oncogene. 2007;26(15):2157-65. doi: https://doi.org/10.1038/sj.onc.1210302
48. Chang-Claude J, Ambrosone CB, Lilla C, et al. Genetic polymorphisms in DNA repair and damage response genes and late normal tissue complications of radiotherapy for breast cancer. Br J Cancer. 2009;100(10):1680-6. doi: https://doi.org/10.1038/sj.bjc.6605036
49. Dumont P, Leu JIJ, Della Pietra AC, et al. The codon 72 polymorphic variants of p53 have markedly different apoptotic potential. Nat Genet. 2003;33(3):357-65. doi: https://doi.org/10.1038/ng1093
50. Francisco G, Menezes PR, Eluf-Neto J, et al. Arg72Pro TP53 polymorphism and cancer susceptibility: a comprehensive meta-analysis of 302 case-control studies. Int J Cancer. 2011;129(4):920-30. doi: https://doi.org/10.1002/ijc.25710
51. Bergamaschi D, Samuels Y, Sullivan A, et al. iASPP preferentially binds p53 proline-rich region and modulates apoptotic function of codon 72-polymorphic p53. Nat Genet. 2006;38(10):1133-41. doi: https://doi.org/10.1038/ng1879
52. Schmidt MK, Tommiska J, Broeks A, et al. Combined effects of single nucleotide polymorphisms TP53 R72P and MDM2 SNP309, and p53 expression on survival of breast cancer patients. Breast Cancer Res. 2009;11(6):R89. doi: https://doi.org/10.1186/bcr2460
53. American College of Obstetricians and Gynecologists; Modesitt SC, Lu K, et al. Practice bulletin no 182: hereditary breast and ovarian cancer syndrome. obstet gynecol. 2017;130(3):e110-26. doi: https://doi.org/10.1097/AOG.0000000000002296
54. Brandt A, Lorenzo Bermejo J, Sundquist J, et al. Breast cancer risk in women who fulfill high-risk criteria: at what age should surveillance start? Breast Cancer Res Treat. 2010;121(1):133-41. doi: https://doi.org/10.1007/s10549-009-0486-y
55. Daly MB, Axilbund JE, Buys S, et al. Genetic/familial high-risk assessment: breast and ovarian. J Natl Compr Cancer Netw. 2010;8(5):562-94. doi: https://doi.org/10.6004/jnccn.2010.0043
56. Franzoi MA, Schwartsmann G, Azevedo SJ, et al. Differences in breast cancer stage at diagnosis by ethnicity, insurance status, and family income in young women in the USA. J Racial Ethn Health Disparities. 2019;6(5):909-16. doi: https://doi.org/10.1007/s40615-019-00591-y
57. Vos JR, Bock GH, Teixeira N, et al. Proven non-carriers in BRCA families have an earlier age of onset of breast cancer. Eur J Cancer. 2013;49(9):2101-6. doi: https://doi.org/10.1016/j.ejca.2013.02.018
58. Fabiano V, Mandó P, Rizzo M, et al. Breast cancer in young women presents with more aggressive pathologic characteristics: retrospective analysis from an Argentine National Database. JCO Glob Oncol. 2020;6:639-46. doi: https://doi.org/10.1200/JGO.19.00228
59. Villarreal-Garza C, Platas A, Miaja M, et al. Young women with breast cancer in Mexico: results of the pilot phase of the joven & fuerte prospective cohort. JCO Glob Oncol. 2020;6:395-406. doi: https://doi.org/10.1200/JGO.19.00264
60. Ambrosone CB. The promise and limitations of genome-wide association studies to elucidate the causes of breast cancer. Breast Cancer Res. 2007;9(6):114. doi: https://doi.org/10.1186/bcr1787
61. Gray JM, Rasanayagam S, Engel C, et al. State of the evidence 2017: an update on the connection between breast cancer and the environment. Environ Health. 2017;16(1):94. doi: https://doi.org/10.1186/s12940-017-0287-4
62. Rodgers KM, Udesky JO, Rudel RA, et al. Environmental chemicals and breast cancer: an updated review of epidemiological literature informed by biological mechanisms. Environ Res. 2018;160:152-82. doi: https://doi.org/10.1016/j.envres.2017.08.045
63. DeRoo LA, Cummings P, Mueller BA. Smoking before the first pregnancy and the risk of breast cancer: a meta-analysis. Am J Epidemiol. 2011;174(4):390-402. doi: https://doi.org/10.1093/aje/kwr090
64. Jones ME, Schoemaker MJ, Wright LB, et al. Smoking and risk of breast cancer in the Generations Study cohort. Breast Cancer Res. 2017;19(1):118. doi: https://doi.org/10.1186/s13058-017-0908-4
65. Kawai M, Malone KE, Tang MTC, et al. Active smoking and the risk of estrogen receptor-positive and triple-negative breast cancer among women ages 20 to 44 years. Cancer. 2014;120(7):1026-34. doi: https://doi.org/10.1002/cncr.28402
66. Zeinomar N, Knight JA, Genkinger JM, et al. Alcohol consumption, cigarette smoking, and familial breast cancer risk: findings from the Prospective Family Study Cohort (ProF-SC). Breast Cancer Res. 2019;21(1):128. doi: https://doi.org/10.1186/s13058-019-1213-1
67. Chelmow D, Pearlman MD, Young A, et al. Executive summary of the early-onset breast cancer evidence review conference. Obstet Gynecol. 2020;135(6):1457-8. doi: https://doi.org/10.1097/AOG.0000000000003889
68. Tobacco smoke and involuntary smoking [Internet]. Lyon (FR): International Agency for Research on Cancer; 2004 [cited 2022 Dec 10]. (IARC Monographs on the Evaluation of Carcinogenic Risks to Humans, no. 83). Available from: https://publications.iarc.fr/_publications/media/download/2636/1567f1ed6fa20d5ef35978ef5b585b63e6101379.pdf
69. Conway K, Edmiston SN, Cui L, et al. Prevalence and spectrum of p53 mutations associated with smoking in breast cancer. Cancer Res. 2002;62(7):1987-95.
70. Ma B, Stepanov I, Hecht SS. Recent studies on DNA adducts resulting from human exposure to tobacco smoke. Toxics. 2019;7(1):16. doi: https://doi.org/10.3390/toxics7010016
71. Pflaum T, Hausler T, Baumung C, et al. Carcinogenic compounds in alcoholic beverages: an update. Arch Toxicol. 2016;90(10):2349-67. doi: https://doi.org/10.1007/s00204-016-1770-3
72. Silva JDDE, Oliveira RR, Silva MT, et al. Breast cancer mortality in young women in Brazil. Front Oncol. 2020;10:569933. doi: https://doi.org/10.3389/fonc.2020.569933
73. Ministério da Saúde (BR), Secretaria de Vigilância em Saúde, Departamento de Análise em Saúde e Vigilância de Doenças Não Transmissíveis. Vigitel Brasil 2019: vigilância de fatores de risco e proteção para doenças crônicas por inquérito telefônico: estimativas sobre frequência e distribuição sociodemográfica de fatores de risco e proteção para doenças crônicas nas capitais dos 26 estados brasileiros e no Distrito Federal em 2019 [Internet]. Brasília (DF): Ministério da Saúde; 2020 [acesso 2022 dez 10]. Disponível em: http://bvsms.saude.gov.br/bvs/publicacoes/vigitel_brasil_2019_vigilancia_fatores_risco.pdf
Recebido em 26/2/2023
Aprovado em 30/3/2023
Scientific-Editor: Anke Bergmann. Orcid iD: https://orcid.org/0000-0002-1972-8777
Este é um artigo publicado em acesso aberto (Open Access) sob a licença Creative Commons Attribution, que permite uso, distribuição e reprodução em qualquer meio, sem restrições, desde que o trabalho original seja corretamente citado.
©2019 Revista Brasileira de Cancerologia | Instituto Nacional de Câncer | Ministério da Saúde